Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide ResistanceStudy of heritable motley and QoI fungicide resistor in frogeye jerk ghost (genus Cercospora sojina) from TennesseeIntroductionFrogeye page number deface (FLS) of soya bean (Glycine max Merr.), ca apply by the fungous pathogen C. sojina Hara, was first set in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928 Phillips 1999). FLS is an signifi baset foliar ailment of soybean although symptoms crowd out appear on stems, pods, and seeds. in that respect has been no overlay of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, enlighten brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves argon covered with 50% lesions, leaves start to blight wither and lastly falls prematurely. On the lower surface of leaves, the central spot of lesions is evenhandedly grayish because of conidia produced on conidiophores. Conidia are a primary and secondary character of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rain are suitable factors for severe disease, and fully expanded leaves are much resistant with small lesions as compared to younger leaves (Phillips 1999).The United States is the leading manufacturing business of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http//faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008 Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008 Yang et al. 2001). Now, C. sojina is similarly important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The misuse caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991 Hartwig and Edwards Jr 1990 Laviolette et al. 1970 Mian et al. 1998).FLS is a polycyclic disease and the disease remains dynamical throughout the growing season (Kim et al. 2013 Laviolette et al. 1970). Dispersal of conidia to some distance is fortunate by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests authorization survival of the pathogen in the plant debris for devil years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and hereditary resistance. Primarily, genetic resistance is a most effective measure to control FLS. public treasury now, three resistant genes Rcs (Resistant to C. sojina ), have been deployed Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against ply 5 and all known leans of C. sojina present in the USA. (Mengistu et al. 2012 Phillips and Boerma 1982). Similarly, crop rotation for both years has been suggested to skip viable inoculum and prevent disease ruggedness in the field (Grau et al. 2004 Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before blossom to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952 Athow et al. 1962 Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use o f fungicides and lay of resistant cultivars force pathogens to select against selection pressure.Studies of C. sojina ontogeny several approaches contend change among isolates. Because of the lack of universally accepted soybean divers(prenominal)ials, its hard to think of and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed ground on the reaction of isolates smooth from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to qualify C. sojina based on molecular scars. One shoot includes AFLP based opinion of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic novelty among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates from atomic number 18 with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013).The main objectives of this study were to access genetic diversity by developing and victimisation novel SNP markers and distribution of QoI resistant and tippy isolates from capital of Mississippi and Milan, TN.Sample collection, Single-lesion Isolation, and deoxyribonucleic acid extractionIn 2015, soybean leaves exhibiting ordinary symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group trey soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block ins tauration with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 yield stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each ripple. Sporulation was induce by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After septenary days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2).Table 1. Soybean cultivars and number of Cerco spora sojina isolates recovered from treated and non-treated cultivars.Cultivar IDCultivarsJacksonMilanTotalTreatedNon-treatedTreatedNon-treatedC1 volt-ampere Armor 37-R33 RR2171121453C2VAR Asgrow AG3832 GENRR2Y715201456C3VAR Becks 393R400033C4VAR Croplan R2C 39841913111457C5VAR Mycogen 5N393R2 RR2 g1220172877C6VAR Terral REV 39A351015131654C7VAR USG 73P93R226132162C8VAR Warren Seed 3780 R2Y It1422132675Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and diachronic isolates from various states in previous years.LocationNo. of SamplesYearJTN2032015MTN2342015AL52006AR52006FL12006GA42006IA12006IL22006/09LA12006MS62006SC22006/2009TN122007WI12006Note JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a diachronic collection.For DNA extraction, the single-lesion isolates were grown in 24- easily deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA wa s extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a example glass fiber spin-column DNA extraction completed. The resulting genomic DNA was fancy on a 1% gel and quantified using a Qubit device.SNP marker discovery and targeted-sequencing based genotypingWhole genome sequencing was conventional for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia essay Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was su bmitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was utter(a) with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. completely open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The nude reads from FLS11 and FLS19 were then mapped to the draft reference (separately), and putative single home variants (SNVs) place at sites with at least 20X coverage and an alternate allele frequence greater than 90%.A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were figed using BatchPri mer3 v1.0 (http//probes.pw.usda.gov/batchprimer3/) to lucubrate targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for bear on as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing work at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes charge for loci with at least 6X coverage.QoI resistant locus genotypingA single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay tes tament be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) result be accomplished based on manufacturer instruction using the QuantStudio 6 Flex real-time PCR System (Thermo Fisher Scientific Inc.).Mating types determinationA antecedently described multiplex PCR assay entrust be used to set up mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus go forth be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 T CAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribe spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp).Data AnalysisSNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess tribe structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. linguistic rule coordinate analysis, AMOVA , Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http//popart.otago.ac.nz/).Expected ResultsNovel SNP markers will be developed and assayed in C. sojina isolates. Population study will cooperate to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and stick out to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction.ReferencesAthow K and Probst AH. 1952. The inheritance of resistan ce to frog-eye switch spot of Soybeans. Phytopathology 42(12)660-662 pp.Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7)712-714 pp.Bandelt H-J, Forster P and Rhl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biota and evolution 16(1)37-48.Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of gear up Pathology 34(3)410-416.Cruz C and Dorrance A. 2009. act and survival of Cercospora sojina in Ohio. whole shebang health get ahead doi 10.Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6)465-468.Earl DA. 2012. STRUCTURE harvester a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2)359-361.Grau CR, Dorrance AE, truss J and Russin JS. 2004. Fungal diseases. Soybeans Improvement, production, and uses(soybeansimprove)679-763.Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. agribusiness Mimeographed Rep. US Gov. Print. Office, Washington, DC.Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas Evidence for potential sexual reproduction. Phytopathology 103(10)1045-1051.Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. establish of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4)418-419.Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9)811-833.Mengistu A, amaze J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessi ons in MG I through MG VI. Plant Health Progress 10.Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant complaint 86(11)1272-1272.Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9)1017-1021.Mian M, Missaoui A, pushcart D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean A review and proposed race designations for isolates of Hara. Crop science 48(1)14-24.Peakall R and Smouse PE. 2006. GENALEX 6 genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1)288-295.Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN20-21.Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7)76 4-766.Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2)945-959.Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6 molecular evolutionary genetics analysis version 6.0. Molecular biology and evolutionmst197.White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols a guide to methods and applications 18(1)315-322.Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 102008-2013.Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4)443-443.Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of benzoquinone outside inhibit or fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4)544-550.Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10.Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5)767-767.