Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide ResistanceStudy of heritable motley and QoI fungicide resistor in frogeye jerk ghost (genus Cercospora sojina) from TennesseeIntroductionFrogeye page number deface (FLS) of soya bean (Glycine max Merr.), ca apply by the fungous pathogen C. sojina Hara, was first set in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928 Phillips 1999). FLS is an signifi baset foliar ailment of soybean although symptoms crowd out appear on stems, pods, and seeds. in that respect has been no overlay of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, enlighten brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves argon covered with 50% lesions, leaves start to blight wither and lastly falls prematurely. On the lower surface of leaves, the central spot of lesions is evenhandedly grayish because of conidia produced on conidiophores. Conidia are a primary and secondary character of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rain are suitable factors for severe disease, and fully expanded leaves are much resistant with small lesions as compared to younger leaves (Phillips 1999).The United States is the leading manufacturing business of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http//faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008 Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008 Yang et al. 2001). Now, C. sojina is similarly important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The misuse caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991 Hartwig and Edwards Jr 1990 Laviolette et al. 1970 Mian et al. 1998).FLS is a polycyclic disease and the disease remains dynamical throughout the growing season (Kim et al. 2013 Laviolette et al. 1970). Dispersal of conidia to some distance is fortunate by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests authorization survival of the pathogen in the plant debris for devil years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and hereditary resistance. Primarily, genetic resistance is a most effective measure to control FLS. public treasury now, three resistant genes Rcs (Resistant to C. sojina ), have been deployed Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against ply 5 and all known leans of C. sojina present in the USA. (Mengistu et al. 2012 Phillips and Boerma 1982). Similarly, crop rotation for both years has been suggested to skip viable inoculum and prevent disease ruggedness in the field (Grau et al. 2004 Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before blossom to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952 Athow et al. 1962 Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use o f fungicides and lay of resistant cultivars force pathogens to select against selection pressure.Studies of C. sojina ontogeny several approaches contend change among isolates. Because of the lack of universally accepted soybean divers(prenominal)ials, its hard to think of and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed ground on the reaction of isolates smooth from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to qualify C. sojina based on molecular scars. One shoot includes AFLP based opinion of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic novelty among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates from atomic number 18 with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013).The main objectives of this study were to access genetic diversity by developing and victimisation novel SNP markers and distribution of QoI resistant and tippy isolates from capital of Mississippi and Milan, TN.Sample collection, Single-lesion Isolation, and deoxyribonucleic acid extractionIn 2015, soybean leaves exhibiting ordinary symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group trey soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block ins tauration with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 yield stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each ripple. Sporulation was induce by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After septenary days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2).Table 1. Soybean cultivars and number of Cerco spora sojina isolates recovered from treated and non-treated cultivars.Cultivar IDCultivarsJacksonMilanTotalTreatedNon-treatedTreatedNon-treatedC1 volt-ampere Armor 37-R33 RR2171121453C2VAR Asgrow AG3832 GENRR2Y715201456C3VAR Becks 393R400033C4VAR Croplan R2C 39841913111457C5VAR Mycogen 5N393R2 RR2 g1220172877C6VAR Terral REV 39A351015131654C7VAR USG 73P93R226132162C8VAR Warren Seed 3780 R2Y It1422132675Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and diachronic isolates from various states in previous years.LocationNo. of SamplesYearJTN2032015MTN2342015AL52006AR52006FL12006GA42006IA12006IL22006/09LA12006MS62006SC22006/2009TN122007WI12006Note JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a diachronic collection.For DNA extraction, the single-lesion isolates were grown in 24- easily deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA wa s extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a example glass fiber spin-column DNA extraction completed. The resulting genomic DNA was fancy on a 1% gel and quantified using a Qubit device.SNP marker discovery and targeted-sequencing based genotypingWhole genome sequencing was conventional for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia essay Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was su bmitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was utter(a) with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. completely open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The nude reads from FLS11 and FLS19 were then mapped to the draft reference (separately), and putative single home variants (SNVs) place at sites with at least 20X coverage and an alternate allele frequence greater than 90%.A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were figed using BatchPri mer3 v1.0 (http//probes.pw.usda.gov/batchprimer3/) to lucubrate targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for bear on as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing work at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes charge for loci with at least 6X coverage.QoI resistant locus genotypingA single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay tes tament be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) result be accomplished based on manufacturer instruction using the QuantStudio 6 Flex real-time PCR System (Thermo Fisher Scientific Inc.).Mating types determinationA antecedently described multiplex PCR assay entrust be used to set up mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus go forth be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 T CAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribe spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp).Data AnalysisSNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess tribe structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. linguistic rule coordinate analysis, AMOVA , Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http//popart.otago.ac.nz/).Expected ResultsNovel SNP markers will be developed and assayed in C. sojina isolates. Population study will cooperate to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and stick out to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction.ReferencesAthow K and Probst AH. 1952. The inheritance of resistan ce to frog-eye switch spot of Soybeans. Phytopathology 42(12)660-662 pp.Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7)712-714 pp.Bandelt H-J, Forster P and Rhl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biota and evolution 16(1)37-48.Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of gear up Pathology 34(3)410-416.Cruz C and Dorrance A. 2009. act and survival of Cercospora sojina in Ohio. whole shebang health get ahead doi 10.Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6)465-468.Earl DA. 2012. STRUCTURE harvester a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2)359-361.Grau CR, Dorrance AE, truss J and Russin JS. 2004. Fungal diseases. Soybeans Improvement, production, and uses(soybeansimprove)679-763.Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. agribusiness Mimeographed Rep. US Gov. Print. Office, Washington, DC.Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas Evidence for potential sexual reproduction. Phytopathology 103(10)1045-1051.Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. establish of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4)418-419.Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9)811-833.Mengistu A, amaze J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessi ons in MG I through MG VI. Plant Health Progress 10.Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant complaint 86(11)1272-1272.Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9)1017-1021.Mian M, Missaoui A, pushcart D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean A review and proposed race designations for isolates of Hara. Crop science 48(1)14-24.Peakall R and Smouse PE. 2006. GENALEX 6 genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1)288-295.Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN20-21.Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7)76 4-766.Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2)945-959.Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6 molecular evolutionary genetics analysis version 6.0. Molecular biology and evolutionmst197.White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols a guide to methods and applications 18(1)315-322.Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 102008-2013.Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4)443-443.Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of benzoquinone outside inhibit or fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4)544-550.Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10.Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5)767-767.

Business Intelligence Solutions for Organisational Goals

problem intuition Solutions for Organisational GoalsInformation dodging is beseeming an chief(prenominal) framework that piece of tail assist system of ruless to exert, win and communicate their intangible assets such(prenominal)(prenominal) as info and conversancy. Therefore it lav be con gradientred as a necessary framework in the current fellowship-based economy atomic number 18na. In this paper, I e precise(prenominal)ow too explain the role of strain Intelligence in providing organizations with a way to plan and obtain their strategic heeds objectives.Than others. Theres almost invariably a prominent inviolable. In the automotive labor, Toyota is considered an exceptional serveer. In comminuted online retailing, Amazon.com is the leader. In off-line retailing Wal-Mart, the sizeablest retailer on earth, is the also leader. In online music, Apples iTunes is considered the superior with much(prenominal) than 75 percent of the d possess irritated music g rocery stores, and in the connect industry of digital music players, the iPod is the best. In Web searching, Google is considered the leader.Firms that do purify than others atomic number 18 said to obligate a warlike good all all over the others They either have access to detail re stocks that others do non, or they are able to apply generally controlal resources more efficiently-usually because of superior knowledge and entropy assets. In any event, they do better in cost of revenue growth, pro jeerability growth, or productivity growth (efficiency), all of which last in the long run translate into toweringer stock market valuations than their competitors. ButWhy do numerous squiffys do better than the others and how do they obtain competitive advantage?How washbowl we fail a pipeline and recognize its strategic advantages?How bottomland we build a strategic advantage for our own air?How do information agreements cause to strategic advantages? wiz answ er to movements above is Michael Porters competitive forces mannikin.Arguably, the most famously use mildew for understanding competitive advantage is Michael Porters competitive forces perplex (See reckon 1).This mystify provides a super acid view of the besotted, its competitors, and the firms surrounds.Porters model is all about the firms common avocation environment. In this model, five competitive forces form the fate of the firm.Figure 1- Porters competitive forces modelCustomersA profitable play along regards in large criterion on its ability to attract and hold clients (while denying them to competitors), and charge more expensive impairments.The power of customers engenders larger if they keister easily switch to a competitors products and services, or if they john force a condescension and its competitors to compete on price alone in a clear mart where in that location is slightly product antitheticaliation, and all prices are known immediately (such as on the net). For example, in the used college textbook market on the internet,students (customers) buttocks find various suppliers of equitable about any current college textbook. In this case, online customers have high power over used-book firms. suppliersThe market power of suppliers can have a grievous impact on firm profits, particularly, when the firm cannot emergence prices as fast as can suppliers. The more different suppliers a firm has, the greater control it can practice over suppliers in terms of price, quality, and deli real timetables. For example, manufacturers of laptop PCs almost always have various competing suppliers of key components, such as keyboards, hard drives, and monitors.CompetitorsAll firms dispense market space with other competitors who are continuously making new, more efficient ways to produce by introducing new products and services, and attempting to attract customers by break offing their brands and compelling switching costs on their cus tomers.New foodstuff EntrantsIn a free economy with moveable labor and financial resources, new companies are always entering the marketplace. In some industries, thither are very low barriers to entry, whereas in other industries, entry is very troublesome. For instance, it is easy to start a pizza barter or dependable about any small retailing communication channel, but it is much more costly and difficult to enter thecomputer chip problem, which has very high capital costs and requires a considerable amount of expertise and knowledge that is hard to achieve. New companies have some(prenominal) possible advantages They are not locked into former plants and equipment, they often employ younger workers who are less expensive and maybe more innovative, they are not burdened by old, worn-out brand names, and they are more hungry (highly motivated) than traditional occupants ofan industry. These benefits are also their weakness They depend on external financing for new plants and equipment, which can be costly they have a less experienced men and they have little brand identification.Substitute Products and ServicesIn just about every industry, there are rilievos that the customers might use if our prices become excessively high. New technologies make new substitutes all the time. Even anoint has substitutes Ethanol can substitute for gasoline in automobiles plant oil for diesel fuel in trucks and wind, solar, coal, and hydro power for industrial electricity production. Likewise, Internet telephone service can substitute for customary telephone service, and fibreoptic telephone lines to the house can substitute for cable TV lines. And, of course, an Internet music service that permits us to download music tracks to an iPod is a substitute for CDbased Music shops. The more substitute products and services in industry, the less we can control pricing and the lower our net profits.Information System Strategies for go about up to Competitive ForcesHow can firms use information systems to neutralize some of the forces outlined in Porters competitive forces model? Four general strategies are outlined in Table-1StrategyDescriptionsExampleLow-cost leading utilisation information systems to produce products and services at a lower price than competitors while enhancing quality and level of service.Wall-Mart, Dell ComputerProduct preeminenceUse information systems to differentiate products, and alter new services and products.Google, eBay, Apple, Lands stopFocus on market nicheUse information systems to enable a focused dodging on a adept market niche specialize.Hilton Hotels HarrahsCustomer and supplierintimacyUse information systems to develop strong ties and loyalty with customers and suppliers.Chrysler Corporation, Amazon.comTable 1-Four basic competitive strategiesLow-Cost LeadershipUse information systems to obtain the lowest usable costs and the lowest prices. Firms such as Wal-Mart have utilized IT to make an efficient customer response system that directly links customer behavior posterior to production, distribution and supply set ups.Product DifferentiationUse information systems to take new products and services, or greatly change the customer convenience in using our existent products and services. Through flock customization, organizations are capable of to bring home the bacon individually tailored products or services by using mass production resources.Focus on Market NicheUse information systems to enable a particular market focus, and serve this narrow target area market better than competitors. Information systems support this strategy by producing and analyzing selective information for extremely well tuned gross sales and marketing techniques. Information systems enable companies to analyze buyer buying patterns, tastes, and preferences closely so that they efficiently establish advert and marketing campaigns to smaller and smaller target markets.Strengthen Customer and Suppl ier IntimacyUse information systems to make tight linkages with suppliers and develop intimacy with customers. Amazon and Chrysler Corporation are both excellent instances that are quoted in the text of how these firms used information systems to fortify their customer and supplier relationships. hearty linkages to customers and suppliers raise switching costs (expense a customer or company incurs in lost time and expenditure of resources when changing from one supplier to a competing supplier).The stemma Value Chain ModelAlthough the Porter model is very useful for identifying competitive forces and suggesting general strategies, it is not very specific about what correctly to do, and it does not provide a methodology to mention for obtaining competitive advantages. If our aim is to achieve operational excellence, where do we start? Heres where the business enterprise place orbit model is really suspensorful.The judge mountain range model highlights specific activities in the business where competitive strategies can best be applied (Porter, 1985) and where information systems are most likely to have a strategic effect. This model recognizes specific, critical-leverage points where a firm can use information technology most effectively to break its competitive position. The value chain model shows the firm as a series or chain of basic activities that add a margin of value to a firms goods or services. These activities can be classified as either primary activities or support activities (see Figure 2).Figure 2- channel Value Chain ModelNow, How can we use information systems to enhance operational efficiency, and improve supplier and customer intimacy? This will instigate us to critically examine how weperform value-adding activities at each phase and how the business processes might be enhanced. We can also begin to ask how information systems can be used to improve the relationship suppliers with customers who locate outside the firm value chain but belong to the firms all-embracing value chain where they are abruptly crucial to our success. Here, supply chain focusing (SCM) systems that arrange the flow of resources into our firm in decorous order, and customer relationship guidance (CRM) systems that coordinate our sales and support employees with customers are two of the most common system applications that bring in from a business value chain analysis. Using the business value chain model will also bring about us to consider benchmarking our business operation versus our competitors or others in related industries, and recognizing industry best practices. Benchmarking involves comparing the effectiveness of business processes against severe standards and then bar performance versus those standards. Industry best practices are usually recognized by consultingcompanies, government agencies, industry associations and research organizations as the most successful dissolving agents for consistently and effectively a chieving a business goal. Once we have analyzed the several stages in the value chain at our business, we can come up with proper applications of information systems. Then, once we have a list of proper applications, we can decide which to build first. By making enhancements in our own business value chain that our competitors might miss, we can obtain competitive advantage by attaining lowering costs, operational excellence, enhancing profit margins, and forging a closer relationship with suppliers and customers. If our competitors are making similar enhancements, then we will not be at a competitive disadvantage-the worst of all casesSynergies and Core CompetenciesA large firm is typically a accretion of businesses. Often, the firm is managed financially as a collection of strategic business units, and the returns to the corporation are directly tied to the performance of all the strategic business units. Information systems can enhance the overall performance of these business u nits by promoting summation competencies and synergies.SynergiesThe aim of synergies is that when the output of some units can be used as inputs to other units, or two organizations pool markets and expertise, these relationships focus costs and make profits. Recent bank and financial firm mergers, such as the mergers of JPMorgan Chase and curse ace Corporation, FleetBoston Financial Corporation and Bank of America, and Deutsche Bank and Bankers Trust, occurred exactly for this intention,One use of information technology in these synergy situations is to fasten together the operations of dissimilar business units so that they can work as a whole. For instance, merging with Bank One provided JPMorgan Chase with a enormous network of retail branches in the south-west and Midwest. Information systems assist the merged banks lower retailing costs and increase cross marketing of financial goods.Enhancing Core CompetenciesAnother way to use information systems for competitive advanta ges is to think about ways that systems can improve core competencies. The argument is that the performance of all business units will try out insofar as these business units improve, or make, a central core of competencies.Core competencies may include being the, the best packaged address service, worlds best miniature parts designer or the best thin-film manufacturer. In general, a core competency leans on knowledge that is gained over umteen years of experience and a first-class research organization or simply key people who pursue the literature and stay side by side of new external knowledge. whatsoever information system that supports the sharing of knowledge across business units enhances competency. Such systems might encourage or improve existing competencies and help employees become conscious, of new external knowledge such systems might also facilitate a business leverage existing competencies to related markets.The Impact of communication channel Intelligence on Com petitive AdvantageBusiness Intelligence is becoming crucial for many organizations, particularly those have extremely large amount of selective information. Decision makers depend on detailed and exact information when they have to make finalitys. Business Intelligence can provide last makers with such precise information, and with the adequate tools for data analysis.Business Intelligence is an umbrella term that combines tools, architectures, applications, data bases, practices, and methodologies 20, 6. Gartner meeting (1996) (the first company used Business Intelligence in soft touch in the mid-1990) defined Business Intelligence as information and applications available broadly to employees, consultants, customers, suppliers, and the public. The key to thriving in a competitive marketplace is staying ahead of the competition. Making sound business finiss based on accurate and current information takes more than intuition. entropy analysis, reporting, and query tools can help business users dig in the mine of data to extract and/or synthesize valuable information from it today these tools collectively fall into stratum called Business Intelligence 9. Many organizations who built successful Business Intelligence solutions, such as Continental Airlines, have seen investment in Business Intelligence create increases in revenue and cost saving jibe to 1000% return on investment (ROI) 22.A critical question that was raised by many researchers 16, 18 as to what were the main reason force companies to seek for business intelligence solutions, and what distinguishes Business Intelligence from Decision offer System (DSS) systems?Actually, over the last decades, organizations built a lot of usable Information Systems (OIS), resulting in an enormous amount of dissimilar data that are located in different geographic locations, on different memory platforms, with not the same forms. This situation impedes organization from building a general, correlated, i ntegrated, and instantaneous access to information at its global level. DSS demonstrable during the 1970s, with the objective of providing organizations decision makers with the demanded data to sustain decision-making process. In the 1980s, Executive Information System (EIS) developed to supply executive officers with the information needed to support strategic decision-making process. Business Intelligence developed during the 1990s as data-driven DSS, sharing some of the tools and objectives of DSS and EIS systems. Business Intelligence architectures comprise business analytics, data warehousing, business performance management, and data mining. Most of Business Intelligence solutions are facing up to organise data 1. However, many application domains need the use of unstructured data or at lowest semi-structured data e.g. customer e-mails, web pages, sales reports, competitor information research paper repositories, and so on 4, 21. Any Business Intelligence solution can be di vided into the pursual three layers 1 data layer, which is accountable for storing structured and unstructured data for decision support objectives. Structured data is usually collected in entropy Warehouses (DW), Operational information Stores (ODS), and Data Marts (DM). Unstructured data are managed by using Content and Document Management Systems. Data are extracted from operational data sources, e.g. SCM, CRM, and ERP or from exterior data sources, e.g. market research data. Data are taken out from data sources that are transformed and loaded into DW by ETL (Extract, Transfer, and Load) tools. Logic layer prepares in operation(p)ity to examine data and provide knowledge. This obtains OLAP, data mining. And finally access layer, realized by some type of parcel portals (Business Intelligence portal).My main focus in this paper is to explain the function of Business Intelligence solution that facilitates organizations in formulating, implementing, and obtaining their strategie s. Many researchers 5, 17, 10, 12 were emphasizing the IT conjunction in general, with businesses, without clearly describing what are the technologies, and tools that can assist organizations in achieving their strategy.The side by side(p) section will describe the role of Business Intelligence is victorious as an IT-enabler to obtain organizations strategy such role will be emphasized by using strategic alignment model proposed by Henderson and Venkatraman (1993), explaining how this alignment can assist organizations in becoming flexible organizations, net how could Business Intelligence solution prepare organizations with sustainable competitive advantages.Business Intelligence as an IT-Enabler to Achieve Organizations StrategyNowadays, Information System in general, and Business Intelligence as a strategic framework, is becoming progressively significant in strategic management, supporting business strategies. IT-enabled strategic management addresses the IT role in strateg y formulation and implementation processes 19. Drucker, the pioneer of management by objectives, was one of the first who recognized the surprising changes IT presented to management. Strategic management theories were widely geared towards gaining competitive advantages. Porter (1979) proposed a number of very influential strategic analysis models, such as the five-force model of competition, the value chain and generic competitive strategies that I mentioned above. Porter (1979) said The spirit of strategy formulation is coping with competition 14. Many researchers have indicated the splendour of IT alignment with business strategy in order to enhance corporate strategy 5, 17, (Figure3).Figure 3-IT alignment with Business Strategy 5.Strategic co-occurrence Model was developed by Henderson and Venkatraman (1993) was one of the first models that explained in a clear way the interrelationships between business strategies and IT strategies 10. This model is based on two principal concepts (Figure 4)strategic fit that identifies the necessity to position the firm in an external marketplace where growth can take place, and functional integration which addresses how to best structure internal systems to carry out the business strategy of the firm 12.IT alignment is not only formulating IT strategy to fit business strategy. It has to consider exterior forces and the environment uncertainty. Such alignment facilitates organizations becoming flexible organizations. Due to accelerations in the rates of innovation and technological changes, markets develop rapidly, products life cycles get shorter and innovation becomes the principle source of competitive advantage. And so, organizations envision for flexibility to meet market demands. Drnevich and other (2006) illustrated that flexibility-based perspectives evolved from Schumpeters concept of creative ending 8.Operationalization of these perspectives in strategic management is done by way of propellent capabilit ies and real options views. Dynamic capabilities view refers to the firms abilities to maintain and fit its internal resources to environment changes to maintain sustainability of competitive advantages. It applies to the capability of obtaining new ways of competitive advantage. It causes to be concerned with continuous search, innovation and adaptation of firm resources and capabilities to reveal and put down new sources of competitive advantages. Real options outlook is effective in dealing with issues of uncertainty. It allows the firm to postpone investment decisions until uncertainties are resolved. New IT organizational toleration expedites the transition into flexible organizations. Business Intelligence is one of these new IT frameworks that can assist such transition. Business Intelligence technologies become a source of competitive advantages and differentiation 13, 11. Tang and Walters (2006) hint that competitive advantage became a hot strategic management topic 19. They also view that making new knowledge in a continued way is the single way to achieve competitive advantage.There are many reasons for organization to adopt business intelligence systems in order that achieve organizations strategyBusiness Intelligence is considered as an expansion to corporate strategy activities. herring (1988) considered that Strategy can be no better than the information from which it is derived 11.Data analytics can be used efficiently to create future business strategy.Data analytics and data mining could disclose hidden reasons for some deficiencies as well as possible high-yielding new investments.Corporations require to be sealed that they are receiving the right information related to their long-term strategy.Herring (1988) considered that business intelligence can facilitate organizations in 11Supporting the strategic decision making process of the firm.Supporting SWOT analysisSupporting strategic planning and processes.All the mentioned advantage sho uld provide organizations with sustainable competitive advantages. endingIn this paper, I explained the use of one aspect of Information System (Business Intelligence) in formulating, implementing, and achieving organizations strategy. I also demonstrated how Business Intelligence solution could provide organizations with sustainable competitive advantages.This survey can be extended by integrating knowledge management (KM) with Business Intelligence (IB) solutions, as it can assist deriving more value (knowledge) from the explosion of textual information(tacit to implicit), which can add more inputs for strategic decision makers. Another important factor is the take advantage of agile methodologies in order to manage the high-change high-speed current environment. Such complicated and dynamic environments highly put on organizations strategies.

Soft Powers Relationship With Hard Power

piano abilitys Relationship With with child(p) antecedentThe dec hunt of U.S. saturated indi tooshiet perturbed the rabid US nationalists. Hence in response to US declining touchy situation came the concept of velvet soldiery group. Joseph S. Nye first developed the concept of daft actor in Bound to Lead, a arrest in say to Paul Kennedys book The Rise and Fall of great indi rout outts In this book Paul Kennedy had announced the decline of US former. Mr. Nye disputed Kennedys claim that US was in decline. At that time he pointed out that the United States was non only when the strongest nation in host and stinting terms, solely as well as in a third dimension which he called comfortable billet.He defined lenient author as the ability to snuff it what you compliments d superstar attraction rather than by coercion or payments. It arises from the attractiveness of a countrys culture, political ideals and policies. When our policies be seen as legitimate i n the look of others, our daft occasion is liftd.iThe greatest cite of magnate in transnational affairs today, says Joseph S Nye, Dean of Kennedy School of Government, Harvard University and the leading proponent of barmy magnate, may lie in persuading other nations to see your interests as their interests. be this assertion persuading others that our respective interests are aligned is the fact that we live in a world where countries arse no longer live in splendid isolation. Globalization has been the juggernaut propelling interconnectedness and global media the chewing gum that binds people across continents.iiHe went on to say that this motive could be cultivated through transaction with allies, frugal assistance and cultural swops. He argued that this would result in a more favourable Public belief and credibility abroad. Later Joseph S. Nye authored two more books titled soft spring The instrument to success in world politics and Paradox of the Statesn p ower Why the worlds only super power pharisaism go it alone.Hans Morgenthau has defined power as, Ability of a nation to persuade, influence, force or otherwise induce another nation to take an action or change an objective that the latter would otherwise not p conjure up to of its own.iii indicator is an ability of an actor to impose its will on others. In this awareness three basic conditions are required so that big businessman offer come into existence. First, an actor essential puzzle the possibilities/ assets to influence other actors. quantitative elements like force and economic possibilities and unquantifiable elements like culture, value system and personal manner of life constitute the first dimension of Power. Second, the actor having these power elements moldiness be conscious of having them. In other words, the actor moldiness have the will to capitalize on these assets. Thirdly, the other actors in the system must recognize and acknowledge that power. For po wer to exist, other actors must change their policies in line with the interests of the party that has power. In this sense, power is relational.5. Historically, actors have been using military and economic Power to force other actors to fall in line with the preferences of power holders. In other words, it forced the other actors to undertake a cost-benefit analysis. It is this cost-benefit analysis which determined the preferences of other actors. An actor preferring to use herculean power will frighten, buy or coax the adversary.iv6. Contrary to Hard Power fragile Powervis the Power of culture, value system, mode of life. The distinction amongst Hard and Soft power is made on the basis of the instrumental role used. n forevertheless Tarik Oguzlu disputes this basis of categorizing Hard and Soft Power. According to him what sacks power Soft is not the nature of means employed but the way those means are employed. Military power is not Hard Power and civil power is not Soft Power. Military and civilian chances of power refer to the kinds of means utilized. Hard and Soft dimensions of power refer to the ways military and civilian elements of power are used.vi7. Joseph S Nye also points out in his article Think Again Soft Power, that the term Soft Power has been stretched and cracked.viiThe popular understandings of the concept encompass a narrower sense and broader sense. In the narrower sense, velvety power is similar to cultural influence. Prominent examples of this view include those of British historian Niall Ferguson and German publicist Josef Joffe. The majority school of thought on low-key power in chinaware also subscribes to this narrower sense. In the broader sense, ticklish power is synonymous with non-military power and includes some(prenominal) cultural power and economic strength. While these popular understandings are interprets, Scholars have argued that more of the confusion and misunderstanding of the concept of aristocratic power is due to its being under-theorized, lack of schoolman refinement, and analytical fuzziness.8. Power always depends on context. To draw and quarter the context of power in the 21st century, Joseph S. Nye uses the illustration of a three dimensional rig game on the top plug-in of the three-dimensional game, the United States is the worlds only superpower, and one is unlikely to see a balance in military power for the next decade or two or mayhap even more. save on the middle board of economic relations amongst states, there is already a balance of power. The United States can not get a craft agreement or an anti trust solution if the European Union acts collectively, and without that balance and agreement, one cant achieve the desired outcomes. It is a bit anomalous to call outside(a) economic relations American Hegemony or empire. plainly if one goes to the posterior board of transnational relations, problems across borders outside the control of governments, whethe r its infectious diseases or drug smuggling or terrorism, no one is in charge. Power is chaotically organized or distributed. The only ways to deal with these issues is by cooperation among governments. To call that again American empire or American hegemony or unipolarity makes no sense at all. whizz is taking a metaphor from the top board and applying it to the bottom board, where it doesnt fit.viiiNew Threats are arising from the bottom board of transnational relations. While military power can be of more or less use occasionally on the bottom board, more often some other forms of power, particularly Soft Power is required.What makes Soft Power?9. Since daft power is the power to attract, the question, what constitutes soft power? turns, What generates attraction? To answer this question, we must look for the power currencies that cause attraction. According to Alexander L. Vuving ,Associate Professor, Asia-Pacific centralize for Security Studies, there are at least three generic wine power currencies from which both power and its softness are derived. He calls them beauty, brilliance, and benignity.10. kindness is an aspect of the agents relations with others, especially with the client of soft power. It refers to the positive attitudes that you let loose when you treat people, especially when you treat the client. Benignity as a power currency deeds on the tendency of reciprocal altruism that exists in most, if not all, organisms. Among benevolents, it generates soft power through the production of gratitude and sympathy.11. Brilliance is an aspect of the agents relations with its work. It refers to the high performance that you accomplish when you do things. In multinational relations, brilliance manifests itself in various forms, for example, a strong and awesome military, a wealthy and vibrant economy, a rich and radiant culture, or a peaceful and well-run society. Brilliance as a power currency works on the tendency of human beings to lear n from the successes of others. It generates soft power through the production of admiration, which can lead to imitation, or emulation, and respect, or fear, or reverence.12. debaucher in world politics is about the resonance that draws actors close to each other through shared ideals, values, causes, or visions. Opposite values and causes add a firm ground for regimes to see each other as ugly and shared values and causes provide a push toward the acquaintance that the other regime is beautiful, which in turn will encourage confidence, friendship, and cooperation. If others distinguish you in this role, they will adhere to you and look at you for guidance, example, encouragement, and inspiration. Beauty generates soft power through the production of inspiration.ixDialectics of Hard and Soft power13. prima(predicate) facie, there is no direct correlation between Hard Power and soft power. A country may be strong in unmanageable power but yet may be purposeless in soft power and vice-versa. But nonetheless on closer examination it is found that a country strong in Hard Power is not totally impotent in soft power. both country strong in Hard Power is always a role model for aspiring power. Hence aspiring powers are attracted to copy the Soft power of Hard Power holder. This has been the case since antiquity. Since the Roman measure till today every aspiring power imitates Romans.x14. There is a close relationship between the degree of securitization of issues and mode of power used. If the issues of relate were securitised, the tendency to use gruelling power would increase. The main difference between hard and soft power stems from the kind of Logic of action which governs the deportment of actors, and not the kind of instruments employed. If the logic of action is instrumental, i.e. if the goal were to force others to make a cost-benefit analysis through coercing or coaxing strategies, consequently Hard Power occupies the centre-stage. On the o ther hand, if the goal were to ensure that other actors in the system would automatically follow the lead due to power of attraction, then one could refer to the existence of Soft Power. Whereas the concept of Hard Power assumes a strong emphasis on the agent/actor, the concept of Soft power underlines the significance of perceptions others hold vis--vis the agent / actor.xi15. Hard and Soft Power sometimes reinforces and sometimes interferes with each other. A country that courts popularity may be reluctant to exercise its hard power as and when the situation demands. But a country that throws its weight around without regard to the effect on its soft power may find others placing obstacles in the way of its hard power. But rarely can a state totally tack one by the other.xii16. A countrys soft power can incite its hard power. During the Iraq war, the United States needed to persuade the Turkish Government to conduct the fourth Infantry Division across flop to enter Iraq from the labor union. But the Turkish government said no, because the United States had by then become so unpopular. Its policies were perceived as so illegitimate that they were not unbidden to allow this transfer of troops across the country. The net effect was that the after part Infantry division had to go down through the canal, up through the Gulf, and arrived late to the war, which made a difference in the number of troops on the ground. Neglect of Soft Power made definite prohibit effect on hard Power.xiii17. It has been historically observed that state sluttish in Hard Power has exercised strong influence on others by its soft power. This has been the case with disintegrated Italys music. Hobsbawm writesxiv..Cultural hegemony is not an indicator of imperial power, nor does it depend much on it. If it did, Italy, disunited, powerless and poor, would not have dominated International musical life and art from the fifteenth through the eighteenth centuries. Moreover, where cul tural power survives the decline of the power and prestige of the states that one propagated it the Roman Empire, or the french absolute monarchyAdvent of Smart Power18. The term hard power refers to guns and bombs, the military force of a country. Soft power is used to describe other forms of persuasion a country can employ trade deals, extraneous aid, diplomacy, cultural influence and more. Joseph S Nye argues, however, that the most effective leading are actually those who combine Hard and Soft Power skills in proportions that vary with different situations. He calls this Smart Power.xv19. Smart power is a term in international relations defined by Joseph Nye as the ability to combine hard and soft power into a gentle strategy. According to Chester A. Crocker, Fen Osler Hampson, and Pamela R. Aall, smart power involves the strategic use of diplomacy, persuasion, qualification building, and the projection of power and influence in ways that are cost-effective and have politica l and social legitimacy essentially the engagement of both military force and all forms of diplomacy.xviMyths about Soft Power20. Soft Power Is Cultural Power According to Joseph S Nye Soft Power is partly Cultural Power. Power is the ability to alter the behavior of others to get what you want. British historian Niall Ferguson described soft power as non-traditional forces much(prenominal) as cultural and commercial goodish sand. Of course, the fact that a unknown drinks Coca-Cola or wears a Michael Jordan T-shirt does not in itself mean that America has power over him. This view confuses resources with behavior. Whether power resources produce a halcyon outcome depends upon the context. Consider Iran. Western music and videos are anathema to the reigning mullahs, but attractive to many of the younger generation to whom they transmit ideas of independence and alternative. American culture produces soft power among some Iranians, but not others.xvii21. frugal Strength is Sof t Power. Peter Brookes in a new-fashioned article refers to soft power options such as economic sanctions. However, he argues that there is nothing soft about sanctions and they are clearly mean to coerce and are thus a form of hard power. Economic strength can be converted into hard or soft power You can coerce countries with sanctions or woo them with wealth. As Walter Russell Mead has argued, economic power is sticky power it seduces as much as it compels.xviiiTheres no doubt that a successful economy is an important source of attraction. sometimes in real-world situations, it is difficult to distinguish what part of an economic relationship is comprised of hard and soft power. European leaders describe other countries desire to insert to the European Union (EU) as a sign of Europes soft power. Turkey today is making changes in its human rights policies and domestic law to accommodate to EU standards.22. Soft Power is Better than Hard Power. Not necessarily. Because soft powe r has been hyped as an alternative to raw power politics, it is often embraced by honorablely minded scholars and policymakers. But soft power is a description, not an ethical prescription. Like any form of power, it can be wielded for good or ill. Hitler, Stalin, and Mao, after all, possessed a great deal of soft power in the eyes of their acolytes. It is not necessarily better to twist minds than to twist fortification.23. Although soft power in the wrong hands can have horrible consequences, it can in some cases offer virtuously superior means to certain goals. Contrast the consequences of Mohandas Gandhi or Martin Luther King Jrs choice of soft power with Yasir Arafats choice of the gun. Gandhi and King were able to attract inhibit majorities over time, and the consequences were impressive both in effectiveness and in ethical terms. Arafats strategy of hard power, by contrast, killed innocent Israelis and drove Israeli moderates into the arms of the hard right.24. Hard Power c an be Measured and Soft Power Cannot. False. In fact, its quite possible to quantify sources of soft power. One can, for example, measure and compare the cultural, communications, and diplomatic resources that might produce soft power for a country. Public opinion polls can quantify changes in a countrys attractiveness over time. Nor is hard power as light-headed to quantify. The apparent precision of the measurement of hard power resources is often false and might be called the concrete fallacy. most people act as though the only resources that can change behavior are those that can be dropped on your foot or on a city. But that is a mistake. The United States had far more measurable military resources than North Vietnam, but it nonetheless lost the Vietnam War. Whether soft power produces behavior that we want will depend on the context and the skills with which the resources are converted into outcomes.xix25. Some Goals can only be Achieved by Hard Power. Soft Power is not the solution to all problems. For example, North Korean dictator Kim Jong Ils discernment for Hollywood movies is unlikely to affect his decision on developing nuclear weapons. Hard power just might dissuade him, particularly if China agreed to economic sanctions. Nor will soft power be decent to stop the Iranian nuclear program, though the legitimacy of the administrations current bipartite approach may help to recruit other countries to a conglutination that isolates Iran. And soft power got nowhere in attracting the Taliban government away from its plunk for for Al Qaeda in the 1990s.It took American military might to do that. But other goals, such as the promotion of democracy and human rights are better achieved by soft power. Coercive democratization has its limits as the United State found out in Iraq. 26. Military Resources fire Only Hard Power. Military force appears to be a formation resource for hard Power, but the same resource can sometimes contribute to Soft Power. Dictators like Hitler and Stalin cultivated myths of invincibility and inevitability to structure expectations and attract others to join their bandwagon. As Osama bin Laden has said, people are attracted to a strong horse rather than a weak horse. A well run military can be a source of attraction, and military to military cooperation and training programs, for example, can establish transnational networks that enhance a countrys Soft Power. Of course, misuse of military resources can also gash Soft Power. Brutality and indifference to just war principles of discrimination and balance wheel can also destroy legitimacy. The efficiency of the initial American military invasion of Iraq in 2003 created admiration in the eyes of some foreigners, but that Soft Power was undercut by the subsequent inefficiency of the occupation and the scenes of mistreatment of prisoners at Abu Ghraib.xx27. Soft Power Is Difficult to Use. Governments can control and change foreign policies. They can sp end money on public diplomacy, broadcasting and exchange programs. They can promote, but not control popular culture. In that sense, one of the key resources that produce soft power is produced by civil society largely independent of government control. from Hollywood to Harvard.xxi28. Soft Power is unlike to the current terrorist bane. False. There is very little likelihood that we can ever attract people like Mohammed Atta or Osama bin Laden. We need hard power to deal with such hard cases. But the current terrorist threat is not Samuel Huntingtons clash of civilizations. It is a civil war between a majority of moderates and a small minority who want to coerce others into their modify and ideologized version of their religion. We cannot win unless the moderates win. We cannot win unless the number of people the extremists are recruiting is displace than the number we are killing and deterring. That equation is hard to balance without Soft power. We cannot win hearts and minds without it. Soft power is more relevant than ever.

Analysing The Compatibility Of Islam And Democracy Politics Essay

Analysing The Compatibility Of Islam And Democracy Politics EssayThis chapter presents the arguments for and against the compatibility of Islam and nation, non to Moslem give ins specifically per se provided more to Moslem-majority lands as a whole. By doing so, it encompasses the wide range of arguments that scholars have made on the be intimate and shows clearly what guides it possible for Islam and body politic to be congruous and what does non. Taking these arguments into consideration, this chapter then puts it into context for Muslim narrates and analyzes if it is possible for them to be pop with show up inwroughtly loosing what makes it an Muslim state.The tellingship between Islam and republic, its compatibility and the issue of the participatory deficit in the Muslim realism is sensation that has been put in the spotlight especially aft(prenominal) the catastrophe and repercussions of September 11 (Hasan 2007 10) as well as the free burning potency of Moslem revivalism and the rise in involvement of Moslem give wayments in electoral politics (Esposito Piscatori 1991 428). Although non all hope is lost for the Muslim initiation as in that respect be Muslim-majority states such as Ind championsia and bomb calorimeter that are recognized as democracies, thither is still the problem of the non-existence of democratic Moslem states and that the majority of the Muslim world re chief(prenominal)s undemocratic.The relationship that Islam and res publica have in the contemporary world and modern-day politics is sensation that is rather complicated (Esposito Voll 2001). There are many panoramas regarding the coexistence of Islam and country. On the one hand, many prominent Moslem intellectuals and groups grapple that Islam and country are compatible (Esposito Voll 2001). On the other(a) hand, there are others who see the democratization of Islam as a threat, that it may promote an even more virulent anti-Westernism sensible horizon or others who see the dickens as inherently antithetical out-of-pocket to the different be inhabitfs that the both promote (Espositio Piscatori 1991 428). Esposito and Voll present the idea that the Muslim world is not ideologic monolithic and therefore presents a broad spectrum of perspectives ranging from the extremes of those who get over a connection between Islam and country to those who argue that Islam requires a democratic system (2001). In addition to this, they argue that there are perspectives that lie in between the two extremes that consist of Muslims in Muslim-majority states who believe that Islam is a support for democracy scorn the situation that their semi semipolitical system and giving medication is not overtly recognized as democratic (Esposito Voll 2001).Having laid out the range of different opinions and stances on the compatibility of Islam and democracy, it is important to note that this chapter provide not deal with any sing le argument present in the on-going debate of the relationship between Islam and democracy that rather cogitate on the main substantial points. Khan, in his book Moslem participatory Discourse, identifies two main enlightens of notion of Islamic political theory. First there are the political Islamists who advocate the establishment of an Islamic state, an authoritarian and ideological entity whose central conceits are al-Hakimiyyah (the reign of graven image) and Sharia (the truth of God) (Khan 2006 160). The second condition of thought is that of liberal Muslims who advocate an Islamic democracy whose central themes are Shura (consultation) and Sahifat al Madinah ( typographyalism a la the Compact of Medina) (Khan 2006 160). It is signifi stoolt to note that political Islamists do conceive the concept of Shura as a vital percentage of their Islamic state, just for them consultative regime is not necessary for authenticity, since legitimacy comes from the enforcement of the Sharia, regardless of the will of the lot (Khan 2006 160). For liberal Muslim scholars, on the other hand, Shura is a paramount and Sharia too must be arrived at through consultative processes and not taken as given (Khan 2006 160).Therefore, it can be seen that political Islamists, according to Khan, do not see the contend for democracy as the legitimacy democracy is meant to give to a states governance and politics is done through the implementation of the Sharia laws. El Fadl argues that for democracy to work inside the framework of Islam and its ideals, it must understand the centrality of Gods sovereignty in Islam and cannot eliminate the element of the Sharia laws as a whole but rather show how it respects and compliments it. However, El Fadls argument is not feasible as it is not possible to enforce Sharia without victorious into consideration the will of the people because that already is considered undemocratic. Khan argues that the exactly flair El Fadls Islami c state can be democratic is if the federal agency of those who interpret the Sharia are dismantled and interpreted by the people themselves (2006 161). This in turn may jeopardize the quality of Islamic democracy within the state but according to Khan, it is a risk that should be taken for the sake of implementing democracy (2006 161).Moving on to the second school of thought, liberal Muslims, who believe in an Islamic democracy centred on the ideals of Shura and the temper of Medina. Esposito and Picastori argue that Muslim indications of democracy build on the well-established concept of Shura (consultation), but place varying emphases on the extent to which the people are rotate to exercise this duty (1991 434). They identify a perspective that claims that it is not solo the notion of consultation that makes Islam intrinsically democratic, but it is also due to the concepts of ijthihad (independent reasoning) and ijma (consensus) (Esposito Picastori 1991 434). The Constit ution of Medina establishes the importance of consent and cooperation for governance and according to this compact Muslims and non-Muslims are jibe citizens of the Islamic state, with monovular rights and duties (Khan 2001). Khan argues that according to this constitution, which was the interpretation of the rule book by Prophet Muhammad, the principles of equality, consensual governance and pluralism are integrated into the Islamic state (2001). He then goes on to point out the difference between Muhammads democratic and tolerant Islamic state to contemporary Muslims such as the Taliban, who interpret the account book in a completely different and entire way (Khan 2001).Choudry backs up the liberal Muslim perspective by assert that the fundamentals of democracy are present in Islam Islam recognizes popular sovereignty, governing is based on rule of law, political leaders are take and accountable to the people and equality of citizens is ensure in the Quran itself (Choudry in Ehteshami 2004 96). But if this were the wooing in all Muslim-majority countries, why are there so few democracies in the Muslim world? The answer is simple. using Khans argument regarding the interpretation of the Quran, it can be argued that the compatibility of Islam and democracy depends on the interpretation of Islamic spiritual scriptures of the Quran by Muslims themselves. Khan argues along identical lines stating that all arguments that advocate Islamic democracies or the compatibility of Islam and democracy take the Quran as a revealed document, whose text is absolute but meanings are open to interpretations (2006 158). This is a very important piece of information as it highlights the fact that when the Quran is interpreted differently by different Muslims it would result in different understandings of what the Quran encompasses. This would explain why not all Muslim-majority states, Islamic states in particular, are similar in the extent to which Sharia law is use in aspects of governance, economics and everyday life.Additionally, Khan uses the theologian perspective to back up liberal Muslim scholars as theologians go to Islamic roots and identify and exemplify those elements that correspond to liberal democratic principles (2006 158) thereof specifically looking for democratic ideals present in Islam. In his book, The Islamic Roots of Democratic Pluralism, theologian Sachedina relies solely on Quranic sources and eschewing other socially constructed discourses, how Islam strongly advocates pluralism (Khan 2006 158). However, just because Islam promotes pluralism, does not instantly make it democratic. Liberal Muslims and theologians make the mistake of macrocosm complacent with the fact that just one or two aspects of democracy are found in Islam, namely Shura and aspects of pluralism, so automatically making Islam and democracy compatible. If this were the case, democracy would be more dominant in the Muslim world.Maududi uses the theolo gian perspective when studying Islam as he also argues that whatever aspect of the Islamic ideology one may like to study, he must, first of all, go to the roots and look at the fundamental principles (1977 119-120) emphasizing the importance of having to study Islam from the inside out and not just take it at face value. However, Maududi takes a step unless than theologians and coins the idea of a theo-democracy, the mixture of theocracy and democracy in Islamic states (1977 133). accord to theo-democracy, God is equally sovereign as the people represented by an elected assembly that is controlled by religious leaders (Maududi in pass Redissi 2004 171). Nevertheless, this concept of theo-democracy, as argued by Lane and Redissi, does not fulfil the essential requirement of democracy as the legitimacy of the Mullahs is not derived from the people but from their insight into the Quran (2004 171). Maududi himself points out that a democratic Islamic state would be a fallacy as the sovereignty of God and sovereignty of the people are vulgarly exclusive and that an Islamic democracy would be the antithesis of secular Western democracy (Maududi in Bukay 2007). The issue of sovereignty of God and the people is what distinguishes Islam and democracy. The two are completely different sets of ideals that cannot be feature together as only one can take precedence over the other, and when this is done, a country either is a democracy or an Islamic state.Going back to the concept of Shura, many scholars use this concept to show that Islam has similar values to those of democracy. Shura can be defined as the obligation for Muslims in managing their political affairs to engage in mutual consultation (Esposito Voll 2001). Lane and Redissi argue that the effort to find the missing amour between Islam and modern democracy is focused upon the possibility of finding a link between the concept of consultation Shura and the key institutions of modern democracy the vot e and the participation of the people in relation to the religious elite group including the caliph (2004 170). Ahmad uses the Islamist perspective to argue that the Quran allows Muslims to use Shura and the opportunity of Gods vicegerency to allot a Muslim ruler based on the free will of the Muslim masses (2002) pointing out the democratic aspects of the Quran when it comes to choosing a ruler. However, it seems that despite the fact that Shura is the so-called democratic component of Islam, majority of the Muslim world are not democratic thus proving that it is easy to correlate the two (Shura and democracy) as similar entities in theory but in practice, it is not enough to ensure a democratic Muslim-majority state, let alone an Islamic state. As Khan puts it a democratic theory cannot just cut by itself from a part of a verse (2006 158).Apart from Khans two main schools of thought, there is another perspective where in which scholars believe that Islam and democracy are intrins ically incompatible. Sivan suggests that Islam has very little to offer in the estate of politics as after Muhammads death, political history was shaped by circumstances Islamic law had little to no say on constitutional matters (Sivan in Ehteshami 2004 96). According to Sivan, Sharia does not stand a chance of being the superior law of the land when democracy is implemented thus implying that Islamic fundamentals of politics and democracy cannot coexist without one being more superior to the other thus determining whether a state is either Islamic or democratic, they cannot be both. Furthermore, Maududis argument supports that of Sivans as he claims that an Islamic democracy would be the antithesis of secular Western democracy (Maududi in Bukay 2007).Despite the fact that numerous Muslim activists have rejected the concept of democracy as a western import designed to destroy Islam and the Sharia, there are Muslim and non-Muslim scholars alike that strongly argue that there is no contradiction between Islam and democracy (Ehteshami 2004 94). Ehteshami claims that Muslim teachings and practices of embodied debate, consensus, accountability and transparency, if followed properly, will produce Muslim versions of democratic rule (2004 94). Nevertheless, he argues that if Islam and democracy were to be seen as two different systems, one of the main differences between an Islamic state and a democracy is the land of sovereignty, where in a democratic society sovereignty lies with the people, and in an Islamic state it resides in God (2004 94). Ahmad argues along the same lines as Ehteshami but uses the Islamist get along claiming that a fundamental difference between the Western and Islamist concept of democracy the sovereignty of the people vs. the sovereignty of God or the Shariah (2002). That being said, it is not possible to remove the sovereignty of God and the Sharia and move them to the sidelines of politics within an Islamic state with democracy at the t op, because when that happens, an Islamic state is no longer an Islamic state for the reason that the nub essence of it has been removed and replaced. When put in this context, it is not feasible for an Islamic state to be democratic.Bukay brings up an interesting argument in relation to the compatibility of Islam and democracy. He claims that some Western scholars maintain the Islamist argument that not only are parliamentary democracy and representative elections congruent with Sharia, but that Islam actually encourages democracy (Bukay 2007). Bukay identifies two ways in which these scholars maintain the in a higher place claims either they twist definitions to make them fit the apparatuses of Islamic governing terms such as democracy become relative or they bend the world in Muslim countries to fit their theories (2007). He points out the phrases used by Esposito and his different co-authors such as democracy has many and varied meanings every culture will mold an indepen dent model of democratic government and there can develop a religious democracy (Bukay 2007) proving his above statement true.Having exhausted all the prominent arguments in the general sphere of democracy and Muslim-majority countries, this chapter will now put these arguments into the context of Islamic states specifically. The arguments of political Islamists is one of the few realistic argument that keeps what essentially makes Islamic states Islamic as it does not disregard Sharia as unimportant or unnecessary when it comes to the governance of a Muslim country. Rather it argues the point that for democracy to work within an Islamic state, it is the responsibility of democracy to show that it encompasses Islamic ideals rather than the other way around. The liberal Muslim school of thought is also useful in finding the possibility of Islamic states being democratic as they argue from the point of view that the interpretation of the Quran is what is essential. However, no matter how evident it is in theory that there are possibilities of Islamic states becoming democratic, there is no denying that in practice, not a single Islamic state exists.The non-existence of democratic Islamic states raises a telephone number of important questions Why are there no democratic Islamic states? Why is it possible for Indonesia and Turkey to be democratic but not Pakistan, Iran or Bahrain? Is Islam the sole, main reason why there are no democratic Islamic states? These questions will be answered in the next two chapters as the next chapter focus primarily on specific case studies of Islamic states, namely Pakistan, Iran, Yemen and Bahrain, where as the fourth chapter deals with democratic and semi-democratic Muslim-majority states, such as Indonesia, Turkey, Malaysia and Bangladesh.